Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101362 |
| Name | oriT_pUMNturkey9_IncAC  |
| Organism | Klebsiella pneumoniae strain UMNturkey9 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JRRF01000010 (18858..18962 [-], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 46..51, 56..61 (ATTCCA..TGGAAT) 1..6, 8..13 (AATTTG..CAAATT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_pUMNturkey9_IncAC
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1806 | GenBank | NZ_JRRF01000010 |
| Plasmid name | pUMNturkey9_IncAC | Incompatibility group | IncA/C2 |
| Plasmid size | 64008 bp | Coordinate of oriT [Strand] | 18858..18962 [-] |
| Host baterium | Klebsiella pneumoniae strain UMNturkey9 |
Cargo genes
| Drug resistance gene | aac(3)-VIa, ant(3'')-Ia |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merA, merB, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |