Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101347 |
| Name | oriT_pIncHI1B_vir  |
| Organism | Klebsiella pneumoniae strain SP4257 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JACXCA010000012 (41039..41066 [+], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_pIncHI1B_vir
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1791 | GenBank | NZ_JACXCA010000012 |
| Plasmid name | pIncHI1B_vir | Incompatibility group | IncHI1B |
| Plasmid size | 151203 bp | Coordinate of oriT [Strand] | 41039..41066 [+] |
| Host baterium | Klebsiella pneumoniae strain SP4257 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | iucA, iucB, iucC, iutA |
| Metal resistance gene | terE, terD, terC, terB, terA, terZ, terW, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pbrA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |