Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101331
Name   oriT_pRHB37-C09_25 in_silico
Organism   Escherichia fergusonii strain RHB37-C09
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXSH010000025 (1183..1242 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHB37-C09_25
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1775 GenBank   NZ_JABXSH010000025
Plasmid name   pRHB37-C09_25 Incompatibility group   ColRNAI
Plasmid size   5596 bp Coordinate of oriT [Strand]   1183..1242 [-]
Host baterium   Escherichia fergusonii strain RHB37-C09

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -