Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101324
Name   oriT_pRHB37-C07_23 in_silico
Organism   Escherichia fergusonii strain RHB37-C07
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXSI010000023 (2807..2866 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHB37-C07_23
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1768 GenBank   NZ_JABXSI010000023
Plasmid name   pRHB37-C07_23 Incompatibility group   ColRNAI
Plasmid size   5596 bp Coordinate of oriT [Strand]   2807..2866 [-]
Host baterium   Escherichia fergusonii strain RHB37-C07

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -