Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101317
Name   oriT_BSN50-3|pSAP046B in_silico
Organism   Staphylococcus aureus strain BSN50-3
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAXMNP010000013 (208..396 [-], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 133..138, 142..147  (TCTGGC..GCCAGA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_BSN50-3|pSAP046B
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1761 GenBank   NZ_JAXMNP010000013
Plasmid name   BSN50-3|pSAP046B Incompatibility group   -
Plasmid size   3111 bp Coordinate of oriT [Strand]   208..396 [-]
Host baterium   Staphylococcus aureus strain BSN50-3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -