Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101311 |
| Name | oriT_pUY79  |
| Organism | Paenibacillus farraposensis strain UY79 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAFFQR010000001 (8198..8229 [-], 32 nt) |
| oriT length | 32 nt |
| IRs (inverted repeats) | 2..8, 12..18 (ACATTGC..GCAATGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 32 nt
>oriT_pUY79
CACATTGCGAAGCAATGTATAAGTGCGCCCTT
CACATTGCGAAGCAATGTATAAGTGCGCCCTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1755 | GenBank | NZ_JAFFQR010000001 |
| Plasmid name | pUY79 | Incompatibility group | - |
| Plasmid size | 9328 bp | Coordinate of oriT [Strand] | 8198..8229 [-] |
| Host baterium | Paenibacillus farraposensis strain UY79 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |