Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101303 |
| Name | oriT_97|unnamed4  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain 97 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAJGZE010000057 (2661..2717 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_97|unnamed4
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1747 | GenBank | NZ_JAJGZE010000057 |
| Plasmid name | 97|unnamed4 | Incompatibility group | Col440I |
| Plasmid size | 2754 bp | Coordinate of oriT [Strand] | 2661..2717 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Typhimurium strain 97 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |