Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101300 |
| Name | oriT_SCPM-O-B-8044|unnamed  |
| Organism | Klebsiella pneumoniae strain SCPM-O-B-8044 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NPIJ01000066 (6390..6550 [-], 161 nt) |
| oriT length | 161 nt |
| IRs (inverted repeats) | 40..45, 49..54 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 161 nt
>oriT_SCPM-O-B-8044|unnamed
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1744 | GenBank | NZ_NPIJ01000066 |
| Plasmid name | SCPM-O-B-8044|unnamed | Incompatibility group | IncQ1 |
| Plasmid size | 9073 bp | Coordinate of oriT [Strand] | 6390..6550 [-] |
| Host baterium | Klebsiella pneumoniae strain SCPM-O-B-8044 |
Cargo genes
| Drug resistance gene | aph(3')-VIa |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |