Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101299 |
| Name | oriT_SCPM-O-B-8044|unnamed  |
| Organism | Klebsiella pneumoniae strain SCPM-O-B-8044 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NPIJ01000049 (16112..16139 [+], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_SCPM-O-B-8044|unnamed
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1743 | GenBank | NZ_NPIJ01000049 |
| Plasmid name | SCPM-O-B-8044|unnamed | Incompatibility group | - |
| Plasmid size | 20777 bp | Coordinate of oriT [Strand] | 16112..16139 [+] |
| Host baterium | Klebsiella pneumoniae strain SCPM-O-B-8044 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |