Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101296 |
| Name | oriT_SCPM-O-B-7851|unnamed  |
| Organism | Klebsiella pneumoniae strain SCPM-O-B-7851 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NIDM01000036 (31679..31706 [-], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_SCPM-O-B-7851|unnamed
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1740 | GenBank | NZ_NIDM01000036 |
| Plasmid name | SCPM-O-B-7851|unnamed | Incompatibility group | IncHI1B |
| Plasmid size | 38831 bp | Coordinate of oriT [Strand] | 31679..31706 [-] |
| Host baterium | Klebsiella pneumoniae strain SCPM-O-B-7851 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | terW, terZ, terA, terB, terC, terD, terE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |