Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101293 |
| Name | oriT_FWSEC0023|unnamed3  |
| Organism | Escherichia coli strain FWSEC0023 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RRCX01000199 (1661..1733 [+], 73 nt) |
| oriT length | 73 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT_FWSEC0023|unnamed3
GTCGGGGCGTAGCCCTGACCAGGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGCGTAGCCCTGACCAGGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1737 | GenBank | NZ_RRCX01000199 |
| Plasmid name | FWSEC0023|unnamed3 | Incompatibility group | Col |
| Plasmid size | 2364 bp | Coordinate of oriT [Strand] | 1661..1733 [+] |
| Host baterium | Escherichia coli strain FWSEC0023 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |