Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101286
Name   oriT_pSA14640 in_silico
Organism   Staphylococcus aureus strain BSN61
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAXHDU010000019 (14940..15128 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 133..138, 142..147  (TCTGGC..GCCAGA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_pSA14640
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1730 GenBank   NZ_JAXHDU010000019
Plasmid name   pSA14640 Incompatibility group   -
Plasmid size   27098 bp Coordinate of oriT [Strand]   14940..15128 [+]
Host baterium   Staphylococcus aureus strain BSN61

Cargo genes


Drug resistance gene   aph(3')-III, msr(A), mph(C), blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21