Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101280 |
Name | oriT_FEX725|unnamed2 |
Organism | Escherichia coli strain FEX725 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_PSOV01000055 (498..584 [+], 87 nt) |
oriT length | 87 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_FEX725|unnamed2
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 1724 | GenBank | NZ_PSOV01000055 |
Plasmid name | FEX725|unnamed2 | Incompatibility group | Col |
Plasmid size | 1622 bp | Coordinate of oriT [Strand] | 498..584 [+] |
Host baterium | Escherichia coli strain FEX725 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |