Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101279 |
| Name | oriT_FEX725|unnamed3  |
| Organism | Escherichia coli strain FEX725 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_PSOV01000050 (1692..1773 [+], 82 nt) |
| oriT length | 82 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 82 nt
>oriT_FEX725|unnamed3
GGGTGTCGGGGTGCAGCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTGCACATCCTGTCCCG
GGGTGTCGGGGTGCAGCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTGCACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1723 | GenBank | NZ_PSOV01000050 |
| Plasmid name | FEX725|unnamed3 | Incompatibility group | ColpVC |
| Plasmid size | 2334 bp | Coordinate of oriT [Strand] | 1692..1773 [+] |
| Host baterium | Escherichia coli strain FEX725 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |