Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101278
Name   oriT_FEX725|unnamed9 in_silico
Organism   Escherichia coli strain FEX725
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_PSOV01000042 (6530..6589 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FEX725|unnamed9
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACATAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1722 GenBank   NZ_PSOV01000042
Plasmid name   FEX725|unnamed9 Incompatibility group   ColRNAI
Plasmid size   6724 bp Coordinate of oriT [Strand]   6530..6589 [-]
Host baterium   Escherichia coli strain FEX725

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -