Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101253 |
| Name | oriT_pB17  |
| Organism | Klebsiella pneumoniae strain B17 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NTHV01000059 (3331..3379 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pB17
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 5759..19904
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CK502_RS26985 (CK502_26975) | 772..1586 | + | 815 | Protein_2 | N-6 DNA methylase | - |
| CK502_RS26990 (CK502_26980) | 2211..2741 | + | 531 | WP_095885195 | antirestriction protein | - |
| CK502_RS26995 (CK502_26985) | 2779..3186 | - | 408 | WP_223170089 | transglycosylase SLT domain-containing protein | - |
| CK502_RS27000 (CK502_26990) | 3690..4082 | + | 393 | WP_020805752 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| CK502_RS27005 (CK502_26995) | 4320..5024 | + | 705 | WP_071080847 | hypothetical protein | - |
| CK502_RS27010 (CK502_27000) | 5108..5308 | + | 201 | WP_071080869 | TraY domain-containing protein | - |
| CK502_RS27015 (CK502_27005) | 5377..5745 | + | 369 | WP_049155512 | type IV conjugative transfer system pilin TraA | - |
| CK502_RS27020 (CK502_27010) | 5759..6064 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| CK502_RS27025 (CK502_27015) | 6084..6650 | + | 567 | WP_020316627 | type IV conjugative transfer system protein TraE | traE |
| CK502_RS27030 (CK502_27020) | 6637..7377 | + | 741 | WP_070552836 | type-F conjugative transfer system secretin TraK | traK |
| CK502_RS27035 (CK502_27025) | 7377..8801 | + | 1425 | WP_071080849 | F-type conjugal transfer pilus assembly protein TraB | traB |
| CK502_RS27040 (CK502_27030) | 8798..8983 | + | 186 | WP_038990989 | hypothetical protein | - |
| CK502_RS27045 (CK502_27035) | 9002..9571 | + | 570 | WP_032429300 | type IV conjugative transfer system lipoprotein TraV | traV |
| CK502_RS27050 (CK502_27040) | 9703..10113 | + | 411 | WP_023292154 | hypothetical protein | - |
| CK502_RS27055 (CK502_27045) | 10118..10408 | + | 291 | WP_032429299 | hypothetical protein | - |
| CK502_RS27060 (CK502_27050) | 10432..10650 | + | 219 | WP_095885196 | hypothetical protein | - |
| CK502_RS27065 (CK502_27055) | 10651..10968 | + | 318 | WP_065808171 | hypothetical protein | - |
| CK502_RS27070 (CK502_27060) | 11035..11439 | + | 405 | WP_065808172 | hypothetical protein | - |
| CK502_RS27075 (CK502_27065) | 11482..11883 | + | 402 | WP_065808173 | hypothetical protein | - |
| CK502_RS27080 (CK502_27070) | 11891..12289 | + | 399 | WP_074423045 | hypothetical protein | - |
| CK502_RS27085 (CK502_27075) | 12360..14903 | + | 2544 | WP_095885197 | type IV secretion system protein TraC | virb4 |
| CK502_RS27090 (CK502_27080) | 14903..15292 | + | 390 | WP_020326931 | type-F conjugative transfer system protein TrbI | - |
| CK502_RS27095 (CK502_27085) | 15292..15918 | + | 627 | WP_065808176 | type-F conjugative transfer system protein TraW | traW |
| CK502_RS27100 (CK502_27090) | 15962..16921 | + | 960 | WP_234833367 | conjugal transfer pilus assembly protein TraU | traU |
| CK502_RS27105 (CK502_27095) | 16934..17572 | + | 639 | WP_065901066 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| CK502_RS27110 (CK502_27100) | 17569..17952 | + | 384 | WP_065808179 | hypothetical protein | - |
| CK502_RS27115 (CK502_27105) | 17949..19904 | + | 1956 | WP_095885198 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| CK502_RS27120 (CK502_27110) | 19937..20218 | + | 282 | WP_071080854 | hypothetical protein | - |
| CK502_RS27125 (CK502_27115) | 20208..20435 | + | 228 | WP_065808180 | conjugal transfer protein TrbE | - |
| CK502_RS27130 (CK502_27120) | 20446..20772 | + | 327 | WP_064144773 | hypothetical protein | - |
| CK502_RS27135 (CK502_27125) | 20793..21044 | + | 252 | Protein_32 | conjugal transfer protein TraF | - |
Host bacterium
| ID | 1697 | GenBank | NZ_NTHV01000059 |
| Plasmid name | pB17 | Incompatibility group | - |
| Plasmid size | 21191 bp | Coordinate of oriT [Strand] | 3331..3379 [-] |
| Host baterium | Klebsiella pneumoniae strain B17 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |