Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101247 |
| Name | oriT_pKPC05 P94 |
| Organism | Klebsiella pneumoniae strain KPC05 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NTGJ01000116 (2868..2917 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pKPC05 P94
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1691 | GenBank | NZ_NTGJ01000116 |
| Plasmid name | pKPC05 P94 | Incompatibility group | - |
| Plasmid size | 4874 bp | Coordinate of oriT [Strand] | 2868..2917 [+] |
| Host baterium | Klebsiella pneumoniae strain KPC05 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |