Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101244 |
| Name | oriT_pKPC05 P44  |
| Organism | Klebsiella pneumoniae strain KPC05 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NTGJ01000099 (2188..2347 [-], 160 nt) |
| oriT length | 160 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 160 nt
>oriT_pKPC05 P44
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1688 | GenBank | NZ_NTGJ01000099 |
| Plasmid name | pKPC05 P44 | Incompatibility group | - |
| Plasmid size | 3654 bp | Coordinate of oriT [Strand] | 2188..2347 [-] |
| Host baterium | Klebsiella pneumoniae strain KPC05 |
Cargo genes
| Drug resistance gene | aph(3')-VIa |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |