Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101240 |
| Name | oriT_FWSEC0066|unnamed5  |
| Organism | Escherichia coli strain FWSEC0066 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RREL01000132 (562..644 [-], 83 nt) |
| oriT length | 83 nt |
| IRs (inverted repeats) | 1..6, 15..20 (GGGGTG..CACCCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 83 nt
>oriT_FWSEC0066|unnamed5
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1684 | GenBank | NZ_RREL01000132 |
| Plasmid name | FWSEC0066|unnamed5 | Incompatibility group | ColpVC |
| Plasmid size | 1795 bp | Coordinate of oriT [Strand] | 562..644 [-] |
| Host baterium | Escherichia coli strain FWSEC0066 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |