Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101235 |
| Name | oriT_pE11210p2 |
| Organism | Escherichia coli O104:H4 str. E112/10 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AHAV01000206 (838..961 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 92..99, 113..120 (ATAATGTA..TACATTAT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_pE11210p2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTATTTGAATCATTAACTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATAAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTATTTGAATCATTAACTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATAAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1679 | GenBank | NZ_AHAV01000206 |
| Plasmid name | pE11210p2 | Incompatibility group | - |
| Plasmid size | 2588 bp | Coordinate of oriT [Strand] | 838..961 [+] |
| Host baterium | Escherichia coli O104:H4 str. E112/10 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |