Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101232
Name   oriT_FWSEC0066|unnamed3 in_silico
Organism   Escherichia coli strain FWSEC0066
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RREL01000124 (3998..4350 [-], 353 nt)
oriT length   353 nt
IRs (inverted repeats)      256..263, 272..279  (ACCGCTAG..CTAGCGGT)
 192..198, 206..212  (TATAAAA..TTTTATA)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 353 nt

>oriT_FWSEC0066|unnamed3
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGGGGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1676 GenBank   NZ_RREL01000124
Plasmid name   FWSEC0066|unnamed3 Incompatibility group   -
Plasmid size   8318 bp Coordinate of oriT [Strand]   3998..4350 [-]
Host baterium   Escherichia coli strain FWSEC0066

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -