Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101231 |
| Name | oriT_pIncFIA  |
| Organism | Escherichia coli strain C13S13_CMC8 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAIZPO010000095 (42775..42861 [-], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_pIncFIA
GGGGTGTCGGGGCGAAGCCCTGACCAGGAGGCAATTGTATAATCGCGCGAGCGCGGTTATACAATTGCACATCCTGTCCCGTTTTTC
GGGGTGTCGGGGCGAAGCCCTGACCAGGAGGCAATTGTATAATCGCGCGAGCGCGGTTATACAATTGCACATCCTGTCCCGTTTTTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1675 | GenBank | NZ_JAIZPO010000095 |
| Plasmid name | pIncFIA | Incompatibility group | IncFIA |
| Plasmid size | 43737 bp | Coordinate of oriT [Strand] | 42775..42861 [-] |
| Host baterium | Escherichia coli strain C13S13_CMC8 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |