Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101230
Name   oriT_pCol-IRGK in_silico
Organism   Escherichia coli strain C15S15_CMSHL3
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAIZPQ010000182 (1234..1417 [+], 184 nt)
oriT length   184 nt
IRs (inverted repeats)      106..111, 116..121  (ACCCCC..GGGGGT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 184 nt

>oriT_pCol-IRGK
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAGGCCATAAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1674 GenBank   NZ_JAIZPQ010000182
Plasmid name   pCol-IRGK Incompatibility group   Col
Plasmid size   2492 bp Coordinate of oriT [Strand]   1234..1417 [+]
Host baterium   Escherichia coli strain C15S15_CMSHL3

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -