Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101219
Name   oriT_pSauR261 in_silico
Organism   Staphylococcus aureus strain SauR261
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAIXAK010000013 (11956..12144 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      163..168, 178..183  (ATTTTA..TAAAAT)
 118..123, 130..135  (CCCCAT..ATGGGG)
 100..106, 110..116  (ATCTGGC..GCCAGAT)
 41..46, 48..53  (AAGTGT..ACACTT)
 31..39, 44..52  (AGTGTCACA..TGTGACACT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_pSauR261
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1663 GenBank   NZ_JAIXAK010000013
Plasmid name   pSauR261 Incompatibility group   -
Plasmid size   20728 bp Coordinate of oriT [Strand]   11956..12144 [+]
Host baterium   Staphylococcus aureus strain SauR261

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -