Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101133 |
Name | oriT_pSauR192-1 |
Organism | Staphylococcus aureus strain SauR192 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JAIUDU010000030 (21472..21649 [+], 178 nt) |
oriT length | 178 nt |
IRs (inverted repeats) | 152..157, 167..172 (ATTTTA..TAAAAT) 107..112, 119..124 (CCCCAT..ATGGGG) 89..95, 99..105 (ATCTGGC..GCCAGAT) 44..51, 64..71 (GTCTTTTT..AAAAAGAC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 178 nt
>oriT_pSauR192-1
TGTGACAAACGCAATATATTGTGTCGCAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTGACAAACGCAATATATTGTGTCGCAAAAGTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 1577 | GenBank | NZ_JAIUDU010000030 |
Plasmid name | pSauR192-1 | Incompatibility group | - |
Plasmid size | 35075 bp | Coordinate of oriT [Strand] | 21472..21649 [+] |
Host baterium | Staphylococcus aureus strain SauR192 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | arsR, arsB, arsC, mco |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | AcrIIA21 |