Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101124
Name   oriT_pCol440I in_silico
Organism   Klebsiella pneumoniae strain K6
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAHZQX010000042 (1722..1773 [-], 52 nt)
oriT length   52 nt
IRs (inverted repeats)      7..14, 17..24  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 52 nt

>oriT_pCol440I
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGATATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1568 GenBank   NZ_JAHZQX010000042
Plasmid name   pCol440I Incompatibility group   Col440I
Plasmid size   4163 bp Coordinate of oriT [Strand]   1722..1773 [-]
Host baterium   Klebsiella pneumoniae strain K6

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -