Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101123 |
| Name | oriT_p3127-8  |
| Organism | Klebsiella pneumoniae strain FK3127 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAOVSI010000008 (62599..62684 [+], 86 nt) |
| oriT length | 86 nt |
| IRs (inverted repeats) | 61..68, 73..80 (TTGGTGGT..ACCACCAA) 27..34, 37..44 (GCAAAAAC..GTTTTTGC) 8..14, 20..26 (TGATTTA..TAAATCA) |
| Location of nic site | 53..54 |
| Conserved sequence flanking the nic site |
TGTGTGGTGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 86 nt
>oriT_p3127-8
AATTACATGATTTAAAACGTAAATCAGCAAAAACTTGTTTTTGCGTAGTGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
AATTACATGATTTAAAACGTAAATCAGCAAAAACTTGTTTTTGCGTAGTGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 42466..63252
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OCJ33_RS28340 (OCJ33_28340) | 38368..39099 | - | 732 | WP_000782451 | conjugal transfer complement resistance protein TraT | - |
| OCJ33_RS28345 (OCJ33_28345) | 39148..39633 | - | 486 | WP_000605870 | hypothetical protein | - |
| OCJ33_RS28350 (OCJ33_28350) | 39649..42469 | - | 2821 | Protein_45 | conjugal transfer mating-pair stabilization protein TraG | - |
| OCJ33_RS28355 (OCJ33_28355) | 42466..43848 | - | 1383 | WP_001309243 | conjugal transfer pilus assembly protein TraH | traH |
| OCJ33_RS28360 (OCJ33_28360) | 43826..44218 | - | 393 | WP_000660699 | F-type conjugal transfer protein TrbF | - |
| OCJ33_RS28365 (OCJ33_28365) | 44199..44546 | - | 348 | WP_001309242 | P-type conjugative transfer protein TrbJ | - |
| OCJ33_RS28370 (OCJ33_28370) | 44476..45021 | - | 546 | WP_000059831 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| OCJ33_RS28375 (OCJ33_28375) | 45008..45292 | - | 285 | WP_000624194 | type-F conjugative transfer system pilin chaperone TraQ | - |
| OCJ33_RS28380 (OCJ33_28380) | 45411..45755 | - | 345 | WP_000556796 | conjugal transfer protein TrbA | - |
| OCJ33_RS28385 (OCJ33_28385) | 45769..46518 | - | 750 | WP_263405814 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| OCJ33_RS28390 (OCJ33_28390) | 46505..46762 | - | 258 | WP_000864353 | conjugal transfer protein TrbE | - |
| OCJ33_RS28395 (OCJ33_28395) | 46789..48639 | - | 1851 | WP_000821856 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| OCJ33_RS28400 (OCJ33_28400) | 48636..49273 | - | 638 | Protein_55 | type-F conjugative transfer system pilin assembly protein TrbC | - |
| OCJ33_RS28405 (OCJ33_28405) | 49282..49587 | - | 306 | WP_000224416 | hypothetical protein | - |
| OCJ33_RS28410 (OCJ33_28410) | 49617..50609 | - | 993 | WP_000830838 | conjugal transfer pilus assembly protein TraU | traU |
| OCJ33_RS28415 (OCJ33_28415) | 50606..51238 | - | 633 | WP_001203728 | type-F conjugative transfer system protein TraW | traW |
| OCJ33_RS28420 (OCJ33_28420) | 51235..51620 | - | 386 | Protein_59 | type-F conjugative transfer system protein TrbI | - |
| OCJ33_RS28425 (OCJ33_28425) | 51617..54246 | - | 2630 | Protein_60 | type IV secretion system protein TraC | - |
| OCJ33_RS28430 (OCJ33_28430) | 54372..54719 | - | 348 | WP_000836682 | hypothetical protein | - |
| OCJ33_RS28435 (OCJ33_28435) | 54747..54965 | - | 219 | WP_000556745 | hypothetical protein | - |
| OCJ33_RS28440 (OCJ33_28440) | 55045..55521 | - | 477 | WP_000549587 | hypothetical protein | - |
| OCJ33_RS28445 (OCJ33_28445) | 55514..55735 | - | 222 | WP_001278683 | conjugal transfer protein TraR | - |
| OCJ33_RS28450 (OCJ33_28450) | 55870..56385 | - | 516 | WP_000809881 | type IV conjugative transfer system lipoprotein TraV | traV |
| OCJ33_RS28455 (OCJ33_28455) | 56382..56702 | - | 321 | WP_001057307 | conjugal transfer protein TrbD | - |
| OCJ33_RS28460 (OCJ33_28460) | 56689..57255 | - | 567 | WP_000896599 | conjugal transfer pilus-stabilizing protein TraP | - |
| OCJ33_RS28465 (OCJ33_28465) | 57245..58695 | - | 1451 | Protein_68 | F-type conjugal transfer pilus assembly protein TraB | - |
| OCJ33_RS28470 (OCJ33_28470) | 58695..59423 | - | 729 | WP_001230772 | type-F conjugative transfer system secretin TraK | traK |
| OCJ33_RS28475 (OCJ33_28475) | 59410..59976 | - | 567 | WP_000399780 | type IV conjugative transfer system protein TraE | traE |
| OCJ33_RS28480 (OCJ33_28480) | 59998..60309 | - | 312 | WP_000012113 | type IV conjugative transfer system protein TraL | traL |
| OCJ33_RS28485 (OCJ33_28485) | 60324..60683 | - | 360 | WP_001098992 | type IV conjugative transfer system pilin TraA | - |
| OCJ33_RS28490 (OCJ33_28490) | 60716..60943 | - | 228 | WP_000089263 | conjugal transfer relaxosome protein TraY | - |
| OCJ33_RS28495 (OCJ33_28495) | 61379..61750 | - | 372 | WP_096127601 | hypothetical protein | - |
| OCJ33_RS28500 (OCJ33_28500) | 61944..62327 | - | 384 | WP_001354030 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| OCJ33_RS28505 (OCJ33_28505) | 62662..63252 | + | 591 | WP_000252683 | transglycosylase SLT domain-containing protein | virB1 |
| OCJ33_RS28510 (OCJ33_28510) | 63549..64370 | - | 822 | WP_001234445 | DUF932 domain-containing protein | - |
| OCJ33_RS28515 (OCJ33_28515) | 64481..64777 | - | 297 | WP_001272251 | hypothetical protein | - |
| OCJ33_RS28520 (OCJ33_28520) | 65077..65372 | + | 296 | Protein_79 | hypothetical protein | - |
| OCJ33_RS28525 (OCJ33_28525) | 65691..65816 | - | 126 | WP_001372321 | type I toxin-antitoxin system Hok family toxin | - |
| OCJ33_RS28530 (OCJ33_28530) | 65758..65907 | - | 150 | Protein_81 | plasmid maintenance protein Mok | - |
| OCJ33_RS28535 (OCJ33_28535) | 66129..66848 | - | 720 | WP_001276217 | plasmid SOS inhibition protein A | - |
| OCJ33_RS28540 (OCJ33_28540) | 66845..67279 | - | 435 | WP_000845953 | conjugation system SOS inhibitor PsiB | - |
Host bacterium
| ID | 1567 | GenBank | NZ_JAOVSI010000008 |
| Plasmid name | p3127-8 | Incompatibility group | IncFII |
| Plasmid size | 91040 bp | Coordinate of oriT [Strand] | 62599..62684 [+] |
| Host baterium | Klebsiella pneumoniae strain FK3127 |
Cargo genes
| Drug resistance gene | dfrA12, aadA2, qacE, sul1, blaNDM-5, mph(A), blaTEM-1B, rmtB |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIF11 |