Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101118
Name   oriT_pA-6726-C in_silico
Organism   Shigella flexneri 1b strain A-6726
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JASUAW010000036 (1245..1304 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pA-6726-C
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1562 GenBank   NZ_JASUAW010000036
Plasmid name   pA-6726-C Incompatibility group   Col
Plasmid size   1812 bp Coordinate of oriT [Strand]   1245..1304 [+]
Host baterium   Shigella flexneri 1b strain A-6726

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -