Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101114 |
| Name | oriT1_FWSEC0039|unnamed4  |
| Organism | Escherichia coli strain FWSEC0039 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RRDL01000127 ( 1593..1665 [+], 73 nt) |
| oriT length | 73 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT1_FWSEC0039|unnamed4
GTCGGGGCAAAGCCCTGACCAGGCGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGCGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1558 | GenBank | NZ_RRDL01000127 |
| Plasmid name | FWSEC0039|unnamed4 | Incompatibility group | Col |
| Plasmid size | 2197 bp | Coordinate of oriT [Strand] | 1928..2000 [-]; 1593..1665 [+] |
| Host baterium | Escherichia coli strain FWSEC0039 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |