Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101099 |
| Name | oriT_pZJ119  |
| Organism | Escherichia coli strain ZJ119 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MCDQ01000181 (15557..15609 [+], 53 nt) |
| oriT length | 53 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 53 nt
>oriT_pZJ119
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1543 | GenBank | NZ_MCDQ01000181 |
| Plasmid name | pZJ119 | Incompatibility group | - |
| Plasmid size | 24162 bp | Coordinate of oriT [Strand] | 15557..15609 [+] |
| Host baterium | Escherichia coli strain ZJ119 |
Cargo genes
| Drug resistance gene | mcr-1.1 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |