Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101097
Name   oriT_pZJ3903 in_silico
Organism   Escherichia coli strain ZJ3903
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MCDM01000070 (6823..6875 [-], 53 nt)
oriT length   53 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 53 nt

>oriT_pZJ3903
CACACGATTGTAACATGACCGGAACGGTCTTGTGTACAATCGGTATCGTGCCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1541 GenBank   NZ_MCDM01000070
Plasmid name   pZJ3903 Incompatibility group   -
Plasmid size   24050 bp Coordinate of oriT [Strand]   6823..6875 [-]
Host baterium   Escherichia coli strain ZJ3903

Cargo genes


Drug resistance gene   mcr-1.1
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -