Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101078
Name   oriT1_pColRNAI in_silico
Organism   Enterobacter cloacae strain BR-MHR107
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAODTB010000109 (4014..4073 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT1_pColRNAI
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1522 GenBank   NZ_JAODTB010000109
Plasmid name   pColRNAI Incompatibility group   ColRNAI
Plasmid size   4095 bp Coordinate of oriT [Strand]   4014..4073 [-]; 1..55 [-]
Host baterium   Enterobacter cloacae strain BR-MHR107

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -