Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101077
Name   oriT_pFIA_h in_silico
Organism   Enterobacter cloacae strain BR-MHR107
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAODTB010000089 (1566..1660 [+], 95 nt)
oriT length   95 nt
IRs (inverted repeats)      73..78, 85..90  (AAAAAA..TTTTTT)
 73..78, 84..89  (AAAAAA..TTTTTT)
 27..34, 37..44  (AGCGTGAT..ATCACGCT)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 95 nt

>oriT_pFIA_h
TTTTTTTTCTTTTAATTCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1521 GenBank   NZ_JAODTB010000089
Plasmid name   pFIA_h Incompatibility group   IncFIA
Plasmid size   9514 bp Coordinate of oriT [Strand]   1566..1660 [+]
Host baterium   Enterobacter cloacae strain BR-MHR107

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -