Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 101061
• Name: oriT_pEA1.7
• Organism: Erwinia amylovora strain IH-3-1
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_JAAEUO010000017 (990..1048 [-], 59 nt)
• oriT length: 59 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 59 nt

>oriT_pEA1.7
GGGTTTCGGGCGCAGCGCCGAATCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 1505
• GenBank: NZ_JAAEUO010000017
• Plasmid name: pEA1.7
• Incompatibility group: -
• Plasmid size: 1695 bp
• Coordinate of oriT [Strand]: 990..1048 [-]
• Host baterium: Erwinia amylovora strain IH-3-1

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -