Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 101060
• Name: oriT_pEA4.3
• Organism: Erwinia amylovora strain Ea160-4-51
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_JAAEVY010000040 (3271..3330 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pEA4.3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 1504
• GenBank: NZ_JAAEVY010000040
• Plasmid name: pEA4.3
• Incompatibility group: ColRNAI
• Plasmid size: 4217 bp
• Coordinate of oriT [Strand]: 3271..3330 [-]
• Host baterium: Erwinia amylovora strain Ea160-4-51

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -