Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101059
Name   oriT_p15_2670 in_silico
Organism   Escherichia coli strain PH-2670-18
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_WLVN01000015 (1387..1446 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p15_2670
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1503 GenBank   NZ_WLVN01000015
Plasmid name   p15_2670 Incompatibility group   Col
Plasmid size   1565 bp Coordinate of oriT [Strand]   1387..1446 [+]
Host baterium   Escherichia coli strain PH-2670-18

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -