Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101055
Name   oriT_Ea1-95|pEA6.0 in_silico
Organism   Erwinia amylovora strain Ea1-95
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAAEVV010000018 (1349..1408 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_Ea1-95|pEA6.0
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGACTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1499 GenBank   NZ_JAAEVV010000018
Plasmid name   Ea1-95|pEA6.0 Incompatibility group   Col440I
Plasmid size   5950 bp Coordinate of oriT [Strand]   1349..1408 [-]
Host baterium   Erwinia amylovora strain Ea1-95

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -