Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101054
Name   oriT_FWSEC0034|unnamed4 in_silico
Organism   Escherichia coli strain FWSEC0034
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRDI01000187 (4700..4759 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FWSEC0034|unnamed4
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1498 GenBank   NZ_RRDI01000187
Plasmid name   FWSEC0034|unnamed4 Incompatibility group   ColRNAI
Plasmid size   6754 bp Coordinate of oriT [Strand]   4700..4759 [+]
Host baterium   Escherichia coli strain FWSEC0034

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -