Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101026 |
| Name | oriT_pAM5  |
| Organism | Acidiphilium multivorum |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_008691 (1209..1242 [+], 34 nt) |
| oriT length | 34 nt |
| IRs (inverted repeats) | 1..10, 14..23 (TGCACATTGC..GCAATGTATA) |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 34 nt
>oriT_pAM5
TGCACATTGCAAAGCAATGTATAAGCGCGCACTT
TGCACATTGCAAAGCAATGTATAAGCGCGCACTT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Samarendra K Singh et al. (2007) Nucleotide sequence analysis of cryptic plasmid pAM5 from Acidiphilium multivorum. Plasmid. 58(2):101-14. [PMID:17363056]
Host bacterium
| ID | 1489 | GenBank | NC_008691 |
| Plasmid name | pAM5 | Incompatibility group | - |
| Plasmid size | 5161 bp | Coordinate of oriT [Strand] | 1209..1242 [+] |
| Host baterium | Acidiphilium multivorum |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |