Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101024 |
| Name | oriT_pRJF293  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae strain RJF293 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | CP014009 (2176..2203 [+], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
AGTTTGGTGC |
| Note |
oriT sequence
Download Length: 28 nt
>oriT_pRJF293
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Jianfeng Zhang et al. (2023) Mobilizable plasmids drive the spread of antimicrobial resistance genes and virulence genes in Klebsiella pneumoniae. Genome medicine. 15(1):106. [PMID:38041146]
Host bacterium
| ID | 1485 | GenBank | CP014009 |
| Plasmid name | pRJF293 | Incompatibility group | IncHI1B |
| Plasmid size | 224263 bp | Coordinate of oriT [Strand] | 2176..2203 [+] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae strain RJF293 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | rmpA, iroN, iroD, iroC, iroB, iucA, iucB, iucC, iucD, iutA, rmpA2 |
| Metal resistance gene | terE, terD, terC, terB, terA, terZ, terW, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pbrA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |