Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101023 |
| Name | oriT_pKPHS3  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | CP003225 (103206..103310 [+], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | IR1: 1..6, 8..13 (AATTTG..CAAATT) IR2: 46..51, 56..61 (ATTCCA..TGGAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
AGTTATGTGG |
| Note |
oriT sequence
Download Length: 105 nt
>oriT_pKPHS3
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Jianfeng Zhang et al. (2023) Mobilizable plasmids drive the spread of antimicrobial resistance genes and virulence genes in Klebsiella pneumoniae. Genome medicine. 15(1):106. [PMID:38041146]
Host bacterium
| ID | 1484 | GenBank | CP003225 |
| Plasmid name | pKPHS3 | Incompatibility group | IncA/C2 |
| Plasmid size | 105974 bp | Coordinate of oriT [Strand] | 103206..103310 [+] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
Cargo genes
| Drug resistance gene | resistance to amoxicillin, ampicillin, cephalothin, piperacillin, ticarcillin, amikacin, gentamicin, tobramycin, doxycycline, tetracycline, chloramphenicol, florfenicol, streptomycin, trimethoprim, sulfamethoxazole, aztreonam, cefepime, cefotaxime, ceftazidime and ceftriaxone |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |