Detailed information of oriT

oriT

The information of the oriT region


oriTDB ID   101021
Name   oriT_p-oriT experimental
Organism   
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   -
oriT length   40 nt
IRs (inverted repeats)      3..11, 13..23  (GCAACATGC..AGCATGTTGCT)
Location of nic site      30..31
Conserved sequence flanking the
  nic site    		  _
Note   

  oriT sequence  


Download         Length: 40 nt

>oriT_p-oriT
TCGCAACATGCTAGCATGTTGCTCCGCTTGCAAAAAGAAA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Mingxi Hua et al. (2022) A chromosome-encoded T4SS independently contributes to horizontal gene transfer in Enterococcus faecalis. Cell reports. 41(6):111609. [PMID:36351400]


Host bacterium

ID   1482 GenBank   _
Plasmid name   pCF10-like Incompatibility group   -
Plasmid size    Coordinate of oriT [Strand]   _
Host baterium   

Cargo genes

Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -