Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101020 |
| Name | oriT_pWBG756  |
| Organism | Staphylococcus aureus |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | GQ900472 (19391..19581 [+], 191 nt) |
| oriT length | 191 nt |
| IRs (inverted repeats) | IR1: 134..140, 144..150 (GTCTGGC..GCCAGAT) IR2: 151..157, 164..170 (CTATCAT..ATGATAG) IR3: 129..133, 175..179 (GGAAT..TTTCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 191 nt
>oriT_pWBG756
TGTCTTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTA
TGTCTTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Frances G O'Brien et al. (2015) Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus. Nucleic acids research. 43(16):7971-83. [PMID:26243776]
Host bacterium
| ID | 1481 | GenBank | GQ900472 |
| Plasmid name | pWBG756 | Incompatibility group | - |
| Plasmid size | 24456 bp | Coordinate of oriT [Strand] | 19391..19581 [+] |
| Host baterium | Staphylococcus aureus |
Cargo genes
| Drug resistance gene | resistance to amoxicillin, ampicillin, penicillin and piperacillin |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |