Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101020
Name   oriT_pWBG756 experimental
Organism   Staphylococcus aureus
Sequence Completeness      intact
NCBI accession of oriT (coordinates [strand])   GQ900472 (19391..19581 [+], 191 nt)
oriT length   191 nt
IRs (inverted repeats)      IR1: 134..140, 144..150  (GTCTGGC..GCCAGAT)
  IR2: 151..157, 164..170  (CTATCAT..ATGATAG)
  IR3: 129..133, 175..179  (GGAAT..TTTCC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   

  oriT sequence  


Download         Length: 191 nt

>oriT_pWBG756
TGTCTTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTA

Visualization of oriT structure (The oriT was characterized experimentally)

  oriT secondary structure

Predicted by RNAfold.

Download structure file

  Reference


[1] Frances G O'Brien et al. (2015) Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus. Nucleic acids research. 43(16):7971-83. [PMID:26243776]


Host bacterium


ID   1481 GenBank   GQ900472
Plasmid name   pWBG756 Incompatibility group   -
Plasmid size   24456 bp Coordinate of oriT [Strand]   19391..19581 [+]
Host baterium   Staphylococcus aureus

Cargo genes


Drug resistance gene   resistance to amoxicillin, ampicillin, penicillin and piperacillin
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21