Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101019 |
| Name | oriT2_pWBG762  |
| Organism | Staphylococcus aureus |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | GQ900474 (6517..6706 [+], 190 nt) |
| oriT length | 190 nt |
| IRs (inverted repeats) | IR1: 133..139, 143..149 (GTCTGGC..GCCAGAC) IR2: 150..156, 163..169 (CTATTAT..ATGATAG) IR3: 128..132, 173..177 (GGAAT..ATTCT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 190 nt
>oriT2_pWBG762
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Frances G O'Brien et al. (2015) Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus. Nucleic acids research. 43(16):7971-83. [PMID:26243776]
Host bacterium
| ID | 1480 | GenBank | GQ900474 |
| Plasmid name | pWBG761 | Incompatibility group | - |
| Plasmid size | 26838 bp | Coordinate of oriT [Strand] | 6517..6706 [+] |
| Host baterium | Staphylococcus aureus |
Cargo genes
| Drug resistance gene | resistance to amoxicillin, ampicillin, penicillin and piperacillin |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |