Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101018 |
| Name | oriT1_pWBG762  |
| Organism | Staphylococcus aureus |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | GQ900475 (7332..7520 [-], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | IR1: 118..124, 129..135 (CCCCATT..GATGGGG) IR2: 100..106, 110..116 (ATCTGGC..GCCAGAT) IR3: 83..88, 93..98 (GGAAT..-TTCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 189 nt
>oriT1_pWBG762
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Frances G O'Brien et al. (2015) Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus. Nucleic acids research. 43(16):7971-83. [PMID:26243776]
Host bacterium
| ID | 1479 | GenBank | GQ900475 |
| Plasmid name | pWBG762 | Incompatibility group | - |
| Plasmid size | 54023 bp | Coordinate of oriT [Strand] | 7332..7520 [-] |
| Host baterium | Staphylococcus aureus |
Cargo genes
| Drug resistance gene | resistance to amoxicillin, ampicillin, penicillin and piperacillin |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |