Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101016 |
| Name | oriT_pWBG744  |
| Organism | Staphylococcus aureus |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | NC_018972 (661..849 [+], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | IR1: 132..138, 142..148 (GTCTGGC..GCCAGAC) IR2: 149..155, 162..168 (CTATCAT..ATGATAG) IR3: 127..131, 172..176 (AGAAT..ATTCT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note |
oriT sequence
Download Length: 189 nt
>oriT_pWBG744
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Frances G O'Brien et al. (2015) Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus. Nucleic acids research. 43(16):7971-83. [PMID:26243776]
Host bacterium
| ID | 1477 | GenBank | NC_018972 |
| Plasmid name | pWBG744 | Incompatibility group | - |
| Plasmid size | 27268 bp | Coordinate of oriT [Strand] | 661..849 [+] |
| Host baterium | Staphylococcus aureus |
Cargo genes
| Drug resistance gene | blaZ |
| Virulence gene | sed |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |