Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101014 |
| Name | oriT_pK2044  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | AP006726 (188274..188301 [-], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 15..20, 22..27 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
GTTTGGTGC |
| Note |
oriT sequence
Download Length: 28 nt
>oriT_pK2044
GTTTGGTGCTTATGATCAGAATCTGATG
GTTTGGTGCTTATGATCAGAATCTGATG
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Dongxing Tian et al. (2022) Prevalence of hypervirulent and carbapenem-resistant Klebsiella pneumoniae under divergent evolutionary patterns. Emerging microbes & infections. 11(1):1936-1949. [PMID:35844192]
Host bacterium
| ID | 1475 | GenBank | AP006726 |
| Plasmid name | pK2044 | Incompatibility group | IncFIB |
| Plasmid size | 224152 bp | Coordinate of oriT [Strand] | 188274..188301 [-] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | rmpA, iroN, iroD, iroC, iroB, iutA, iucD, iucC, iucB, iucA |
| Metal resistance gene | pbrA, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE, terW, terZ, terA, terB, terC, terD, terE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |