Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101012 |
| Name | oriT_pRES9a  |
| Organism | Rhizobium leguminosarum |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | AJ278138 (302..342 [+], 41 nt) |
| oriT length | 41 nt |
| IRs (inverted repeats) | 8..13, 18..23 (CGTCGC..GCGACG) |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
A|ATTGCGCCATTGG |
| Note |
oriT sequence
Download Length: 41 nt
>oriT_pRES9a
GCAAGGGCGTCGCGTCAGCGACGTATAATTGCGCCATTGGA
GCAAGGGCGTCGCGTCAGCGACGTATAATTGCGCCATTGGA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sarah L Turner et al. (2002) Identification and analysis of rhizobial plasmid origins of transfer. FEMS microbiology ecology. 42(2):227-34. [PMID:19709282]
Host bacterium
| ID | 1473 | GenBank | AJ278138 |
| Plasmid name | pRES9a | Incompatibility group | - |
| Plasmid size | 583 bp | Coordinate of oriT [Strand] | 302..342 [+] |
| Host baterium | Rhizobium leguminosarum |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |