Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101011 |
| Name | oriT_pRES6b  |
| Organism | Rhizobium leguminosarum |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | AJ278136 (310..343 [+], 34 nt) |
| oriT length | 34 nt |
| IRs (inverted repeats) | 1..6, 11..16 (ACGTCGC..GCGACGT) |
| Location of nic site | 20..21 |
| Conserved sequence flanking the nic site |
A|ATTGCGCCCTTGG |
| Note |
oriT sequence
Download Length: 34 nt
>oriT_pRES6b
CGTCGCGCCAGCGACGTATAATTGCGCCCTTGGA
CGTCGCGCCAGCGACGTATAATTGCGCCCTTGGA
Visualization of oriT structure (The oriT was characterized experimentally)
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sarah L Turner et al. (2002) Identification and analysis of rhizobial plasmid origins of transfer. FEMS microbiology ecology. 42(2):227-34. [PMID:19709282]
Host bacterium
| ID | 1472 | GenBank | AJ278136 |
| Plasmid name | pRES6b | Incompatibility group | - |
| Plasmid size | 584 bp | Coordinate of oriT [Strand] | 310..343 [+] |
| Host baterium | Rhizobium leguminosarum |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |