Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101010 |
| Name | oriT_pRES2b  |
| Organism | Rhizobium leguminosarum |
| Sequence Completeness | intact |
| NCBI accession of oriT (coordinates [strand]) | AJ278134 (304..347 [+], 44 nt) |
| oriT length | 44 nt |
| IRs (inverted repeats) | |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
A|ATTGCGCCCTTGG |
| Note |
oriT sequence
Download Length: 44 nt
>oriT_pRES2b
GCAAGCACGTAGCGTCAGCGACGTATAATTGCGCCCTTGGAACC
GCAAGCACGTAGCGTCAGCGACGTATAATTGCGCCCTTGGAACC
oriT secondary structure
Predicted by RNAfold.
Download structure file
Reference
[1] Sarah L Turner et al. (2002) Identification and analysis of rhizobial plasmid origins of transfer. FEMS microbiology ecology. 42(2):227-34. [PMID:19709282]
Host bacterium
| ID | 1471 | GenBank | AJ278134 |
| Plasmid name | pRES2b | Incompatibility group | - |
| Plasmid size | 585 bp | Coordinate of oriT [Strand] | 304..347 [+] |
| Host baterium | Rhizobium leguminosarum |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |